ZNet Tech is dedicated to making our contracts successful for both our members and our awarded vendors.
We emphasize that our assessments are based solely on contemporary DNA distributions rather than actual prehistoric patterns. A majority of members of G-P303 belong to one of its subclades, rather than to G-P303*, The largest G-P303* subclade based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. There are distinctive Ashkenazi Jewish and Kazakh subclades based on STR marker value combinations. The results were analyzed using the ABI PRISM program GeneMapper 4.0 (Applied Biosystems). In Turkey, the South Caucasus and Iran, haplogroup G reaches the highest percentage of national populations. Zhivotovsky LA, Underhill PA, Cinnioglu C et al. Science 2000; 290: 11551159. Haplogroup A0-T is also known as A-L1085 (and previously as A0'1'2'3'4). The G2 clade consists of one widespread but relatively infrequent collection of P287*, M377, M286 and M287 chromosomes versus a more abundant assemblage consisting of G2a-related P15*, P16 and M485-related lineages. A clade of closely related Ashkenazi Jews represent virtually all G2b persons, with just three other G2b haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan. A relatively high percentage of G2a2b1 persons have a value of 21 at STR marker DYS390. IK thanks the Russian Foundation for Basic Research for grant 08-06-97011 and the Grant of the President of the Russian Federation of state support for young Russian scientists MK-488.2006.4. Kharkov VN, Stepanov VA, Borinskaya SA et al. Proc Natl Acad Sci USA 2011; 108: 1825518259. The new phylogenetic and phylogeographic information provides additional insights into the demographic history and migratory events in Eurasia involving hg G. The present study comprises data from 98 populations totaling 17577 individuals, of which 1472 were members of hg G. The haplogroup frequency data are presented in Supplementary Table S1. Y-DNA haplogroups are useful to determine whether two apparently unrelated individuals sharing the same surname do indeed descend from a common ancestor in a not too distant past (3 to 20 generations). Am J Hum Genet 2002; 70: 265268. [16] The concentration of G falls below this average in Scandinavia, the westernmost former Soviet republics and Poland, as well as in Iceland and the British Isles. Internet Explorer). While it is found in percentages higher than 10% among the Bakhtiari, Talysh people, Gilaki, Mazandarani and Iranian Azeris, it is closer to 5% among the Iranian Arabs and in some large cities. [5] Cinnioglu et al. [10], A skeleton found at the Neolithic cemetery known as Derenburg Meerenstieg II, in Saxony-Anhalt Germany, apparently belonged to G2a3 (G-S126) or a subclade. The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. Pichler I, Fuchsberger C, Platzer C et al. The identities of the specific 19 loci that define the STR haplotypes are reported in Supplementary Table S3 and Figure 4 legend. Hum Genet 2004; 114: 127148. Y-STR haplotypes were used to construct phylogenetic networks for haplogroups G-P303, G-P16 and G-M377, using the program Network 4.6.0.0 (Fluxus-Engineering, Suffolk, England, UK) and applying the median-joining algorithm. Achilli A, Olivieri A, Pala M et al. Haplogroup G was the first branch of Haplogroup F outside of Africa. Hg G is most common in the Caucasus with a maximum frequency exceeding 70% in North Ossetians,2, 3 decreasing to 13% in Iran4 and then rapidly dissipating further eastward. Goncalves R, Freitas A, Branco M et al. Yunusbayev B, Metspalu M, Jrve M et al. Slider with three articles shown per slide. On this Wikipedia the language links are at the top of the page across from the article title. Beginning in 2008, additional G SNPs were identified at Family Tree DNA (L designations) and Ethnoancestry (S designations). In contrast to its widely dispersed sister clade defined by P303, hg G-M406 has a peak frequency in Cappadocia, Mediterranean Anatolia and Central Anatolia (67%) and it is not detected in most other regions with considerable P303 frequency. Flores C, Maca-Meyer N, Gonzalez AM et al. Lacan M, Keyser C, Ricaut FX et al. The National Geographic Society places haplogroup G origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. Capelli C, Brisighelli F, Scarnicci F et al. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. King RJ, DiCristofaro J, Kouvatsi A et al. Circles represent microsatellite haplotypes, the areas of the circles and sectors are proportional to haplotype frequency (smallest circle corresponds to one individual) and the geographic area is indicated by color. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. We performed principal component analysis to determine the affinities of various hg G fractions with respect to total M201 among different populations, using the frequency distributions of the following sub-clades: M285, P20, M377, M287, P287, P15*, P16, M286, M485, P303*, L497, U1*, M527, M406 and Page19. While acknowledging that the inference of the age and geographic source of dispersals of Y chromosome haplogroups from the frequency and STR diversity data can be approximate at best, we speculate that this lineage could potentially be associated with the Linearbandkeramik (LBK) culture of Central Europe, as its highest frequency (3.45.1%) and Td estimate (Supplementary Table S4) of 108703029 years ago occur there. Hg G also occurs at frequencies ranging from 5 to 15% in both the rest of Near/Middle East and southern European countries (especially Italy and Greece), with a decreasing frequency gradient towards the Balkans and northern Europe. (Previously the name Haplogroup M was assigned to K2b1d. Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists. Unresolved G2a-P15* lineages occur across a wide area extending from the Near/Middle East to the Balkans and Western Europe in the west, the Caucasus (especially the South Caucasus) in the north and Pakistan in the east. G2a2b2a is also found in India. Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood. Battaglia V, Fornarino S, Al-Zahery N et al. Here we address this issue with a phylogeographic overview of the distribution of informative G sub-clades from South/Mediterranean Europe, Near/Middle East, the Caucasus and Central/South Asia. Age: About 7,800 years ago Origin: Eurasia Y-Haplotree. [42] The technical specifications of M201 are given as: refSNPid is rs2032636..Y chromosome location of 13536923.forward primer is tatgcatttgttgagtatatgtc..reverse primer is gttctgaatgaaagttcaaacg..the mutation involves a change from G to T. A number of SNPs have been identified with seemingly the same coverage in the population as M201. The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective. Am J Hum Genet 2004; 74: 5061. the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. The Madjar and Argyn tribes (or clans) of Kazakhstan were found to possess the highest levels of G-M201 among any modern ethnic group. The Y-chromosomal haplogroup G (hg G) is currently defined as one of the 20 standard haplogroups comprising the global Y-chromosome phylogeny.1 The phylogeographic demarcation zone of hg G is largely restricted to populations of the Caucasus and the Near/Middle East and southern Europe. Hum Hered 2006; 61: 132143. Martinez L, Underhill PA, Zhivotovsky LA et al. Moreover, these general frequencies mostly consist of two notable lineages. Haak W, Balanovsky O, Sanchez JJ et al. [36], G-PF3359 (or G2a2b2b; previously G2a3b2) was known prior to 2013 as G-L177. The second component, influenced by the relatively high presence of M377, separates Ashkenazi Jews from other populations (Figure 3a). Haplogroup definition, a set of similar haplotypes inherited together, or a group who shares a set of similar haplotypes, used to understand genetic lineages. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. "[3], Previously the National Geographic Society placed its origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic. Provided by the Springer Nature SharedIt content-sharing initiative, European Journal of Human Genetics (2021), European Journal of Human Genetics (2020), European Journal of Human Genetics (Eur J Hum Genet) Although progress has been recently made in resolving the haplogroup G phylogeny, a comprehensive survey of the geographic distribution patterns of the significant sub-clades of this haplogroup has not been conducted yet. EKK thanks the Russian Academy of Sciences Program for Fundamental Research Biodiversity and dynamics of gene pools, the Ministry of Education and Science of the Russian Federation for state contracts P-325 and 02.740.11.07.01, and the Russian Foundation for Basic Research for grants 04-04-48678- and 07-04-01016-. In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. L1771.1/ L177_1, L1771.2/L177_2, L177.3/L177_3) was withdrawn as an identifier by ISOGG in 2013, after it was "found to be an unreliable palindromic snp". In the Tirol (Tyrol) of western Austria, the percentage of G-M201 can reach 40% or more; perhaps the most famous example is the ancient remains of the so-called "Iceman", tzi. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). [43] L240 was identified in 2009. Men who belong to this group but are negative for all its subclades represent a small number today. [38][self-published source?] Hg G is very frequent in NW Caucasus and South Caucasus, covering about 45% of the paternal lineages in both regions2 in this study. The G-M286 subclade (M286+) is small compared with G-L91. This is not surprising, as clines are not expected in cases of sharp changes in haplogroup frequency over a relatively small distance such as those observed for hg G, for instance between the Caucasus and Eastern Europe. [6], A more eastern origin has also been mentioned, believed by some to originate in an area close to the Himalayan foothills. Reduced genetic structure of the Iberian peninsula revealed by Y-chromosome analysis: implications for population demography. The presence of hg G was first reported in Europe and Georgia5 and later described in additional populations of the Caucasus.6 Subsequently, several data sets containing hg G-related lineages have been presented in studies of different European populations7, 8, 9, 10 and so on, as well as studies involving several Middle Eastern and South Asian populations.4, 11, 12, 13, Hg G, together with J2 clades, has been associated with the spread of agriculture,5 especially in the European context. Another frequent sub-clade of the G2a3-M485 lineage is G2a3a-M406 (Figure 2e). . Human Y chromosome DNA grouping common in western Eurasia, This article is about the human Y-DNA haplogroup. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters. Two additional markers, DYS38829, 30 and DYS46131 were typed separately. Age Amongst the Madjars, G1 was found at a rate of 87%. Digora, North Ossetia has the highest known concentration of G in a single city, as 74% of the tested men were G.[14] Haplogroup G is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs. New insights into the Tyrolean Icemans origin and phenotype as inferred by whole-genome sequencing. Supplementary Information accompanies the paper on European Journal of Human Genetics website, Rootsi, S., Myres, N., Lin, A. et al. Geographic spread patterns of the P303-derived groups defined by L497, U1 and P15(xP303)-derived P16 and M406 lineages, all of which achieve a peak frequency of at least 10%, are presented in Figures 2bf, respectively. In Europeexcept in Italy G2a2b1 constitutes less than 20% of G samples. Whereas the presence of Mideastern mtDNA in Tuscany43 supports the model of early Iron Age migrants from Anatolia (putative Etruscans) colonizing Central Italy,44 the occurrence of the G2a3b1c-L497 lineage in Italy is most likely associated to migratory flows from the north. The Sea Peoples, from cuneiform tablets to carbon dating. The extreme rarity of G-M377 in northern Pakistan could indicate that G2b in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). In Russia, Ukraine and Central Asia, members of various ethnic minorities and/or residents in particular localities possess G-M201 at its highest levels in the world even though the average rate at the national level is about 1% or less. Keller A, Graefen A, Ball M et al. Encyclopedia of mtDNA Origins - Discover your maternal lineage. Y chromosomal heritage of Croatian population and its island isolates. 25 and 0.00069 denote the assumed average generation time in years and the effective mutation rate, respectively, and 1000 is used to convert the result of the equation (into thousands of years). Although the present-day frequency of G1 is low across its spread zone, the expansion time estimate (Supplementary Table S4) of 192716158 years attests to considerable antiquity. First, here is the only region with co-presence of deep basal branches as well as the occurrence of high sub-haplogroup diversity of haplogroup G. Furthermore, markers Page94, U5, U8 and L30 were typed in contextually appropriate samples to establish the position of the five new markers within the phylogeny. Taken as a collective group, P303-derived chromosomes are the most widespread of all hg G lineages (Supplementary Table S1 and Figure 2b) and clearly display differential geographic partitioning between L497 (Figure 2c) and U1 (xM527) (Figure 2d). It is a branch of haplogroup G (Y-DNA) (M201). Drawing the history of the Hutterite population on a genetic landscape: inference from Y-chromosome and mtDNA genotypes. In descending order, G-P303 is additionally a branch of G2 (P287), G2a (P15), G2a2, G2a2b, G2a2b2, and finally G2a2b2a. There are multiple SNPs which so far have the same coverage as P15. Men with the haplogroup G marker moved into Europe in Neolithic times. These five major sub-clades of the G2 branch show distinct distribution patterns over the whole area of their spread. Because M201 was identified first, it is the standard SNP test used when testing for G persons. The 12f2a mutation, which characterizes haplogroup J, was observed in 445 subjects. Furthermore, the U1-specific sub-clade M527 is most pronounced among Ukrainians and Anatolian Greeks. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria, Germany, but G2a subclades were not tested.[34]. King RJ, Ozcan SS, Carter T et al. First, the G2a1-P16 lineage is effectively Caucasus specific and accounts for about one-third of the Caucasian male gene pool (Figure 2f). The most probably region of the initial phase of G-M201 is estimated to be in Anatolia, Armenia or western Iran. AAL thanks the Sorenson Molecular Genealogy Foundation. A plot of the sub-clades included in the principal component analysis (Figure 3b) indicates that the clustering of the populations from NW Caucasus is due to their U1* frequency, whereas L497 lineages account for the separation of central Europeans. Among Turkish males 11% of the population is G.[6] In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. Please help update this article to reflect recent events or newly available information. His male-line descendants appear to remained rooted in the region for tens of thousands of years while the Ice Age was in full swing. [7], (Subclades here conform to the Y-DNA SNP definitions used by ISOGG In 2012, several categories found only in one man in research studies were removed from the ISOGG tree causing some renaming. In north-eastern Croatia, in the town of Osijek, G was found in 14% of the males. We attempted to localize the potential geographic origin of . In the Near/Middle East, the highest P303 frequency is detected among Palestinians (17.8%), whereas in Europe the frequency does not exceed 6%. Balanovsky O, Dibirova K, Dybo A et al. G-M406* (G2a2b1*; previously G2a3a*) and its subclades seem most commonly found in Turkey and the coastal areas of the eastern Mediterranean where it can constitute up to 5% of all makes and 50% of haplogroup G samples. Bosch E, Calafell F, Comas D, Oefner PJ, Underhill PA, Bertranpetit J : High-resolution analysis of human Y-chromosome variation shows a sharp discontinuity and limited gene flow between northwestern Africa and the Iberian Peninsula. Mol Biol Evol 2006; 23: 22682270. Am J Hum Genet 2003; 72: 313332. The frequency pattern and the microsatellite network of E-M2(xM191) indicate a West African origin followed by expansion, a result that is in agreement with the findings of Cruciani et al. They arewith accompanying Y-chromosome locationsU5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). Nature 2010; 466: 238242. Various estimated dates and locations have been proposed for the origin of G-M201, most of them in Western Asia. Although hg G1 frequency distribution, overall, extends further eastward as far as Central Asian Kazakhs (present even among Altaian Kazakhs38 with identical STR haplotypes compared with the main Kazakh population), it is virtually absent in Europe. PLoS One 2009; 4: e5792. Pericic M, Lauc LB, Klaric IM, Janicijevic B, Rudan P : Review of croatian genetic heritage as revealed by mitochondrial DNA and Y chromosomal lineages. G-P16 is also occasionally present in Northeast Caucasus at lower frequencies (Supplementary Table S1), consistent with a previous report.3 Outside the Caucasus, hg G-P16 occurs at 1% frequency only in Anatolia, Armenia, Russia and Spain, while being essentially absent elsewhere. In the G2a3b-P303 network (Figure 4), there are several region-specific clusters, indicating a considerable history for this SNP. In the ten remaining populations, haplogroup diversity spanned from a low of 0.21 in Adyghes, to highs of 0.88 in Azeris (Iran) and 0.89 in eastern Anatolia and 0.90 in Armenia. The phylogeny obtained for haplogroup Q-M378 comprising 5.2% of the Ashkenazi paternal variation 24, shows a similar pattern to that observed for haplogroup G-M377 (Supplemental Figure S5). Almost all L141 men belong to L141 subclades. Spatial frequency maps for hg G sub-clades that attained 10% frequency in at least one population were obtained by applying the haplogroup frequencies from Supplementary Table S1. Principal component analysis based on G sub-haplogroup frequencies was performed using the freeware POPSTR program (http://harpending.humanevo.utah.edu/popstr/). ASD0 is the average squared difference in the number of repeats between all current chromosomes of a sample and the founder haplotype, which is estimated as the median of current haplotypes. So far all G2a1 persons have a value of 10 at STR marker DYS392. In human genetics, Haplogroup G-P303 ( G2a2b2a, [2] formerly G2a3b1) is a Y-chromosome haplogroup. Int J Legal Med 1997; 110: 134149. Thus, G2a3a-M406, along with other lineages, such as J2a3b1-M92 and J2a4h2-DYS445=616, may track the expansion of the Neolithic from Central/Mediterranean Anatolia to Greece/Italy and Iran. [2], In 2012, a paper by Siiri Rootsi et al. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of the SNP have to be examined. SD was also calculated for the age estimates according to the following formula: 25/1000 (ASD0 variance)/0.00069. In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation. Origin. Ancient DNA suggests the leading role played by men in the Neolithic dissemination. L141 persons who do not belong to any L141 subclade so far have the value of 11 at STR marker DYS490 a finding rare in other G categories. MH and MHS are thankful to the National Institute for Genetic Engineering and Biotechnology, Tehran, Iran, and the National Research Institute for Science policy, Tehran, Iran, for providing the samples. Spatial frequency maps for sub-clades (panels bf) were obtained by applying the frequencies from Supplementary Table S1 using the Surfer software (version 8, Golden Software, Inc.), following the kriging algorithm with option to use bodies of water as breaklines. Artefactual values below 0% values were not depicted. This haplogroup was found in a Neolithic skeleton from around 5000 BC, in the cemetery of Derenburg Meerenstieg II, Germany, which forms part of the Linear Pottery culture, known in German as Linearbandkeramik (LBK),[11] but was not tested for G2a3 subclades. [21] In a study of 936 Indians, haplogroup G made up less than 1% of the sample and was completely absent in the tested Northwestern Indian population. Eur J Hum Genet 2008; 16: 374386. PLoS Biol 2010; 8: e1000536. Haplogroup G (M201) is a human Y-chromosome haplogroup. Parallel evolution of genes and languages in the Caucasus region. Lacan M, Keyser C, Ricaut FX et al. Interestingly, the L30 SNP, phylogenetically equivalent to M485, M547 and U8, was detected in an approximately 7000-year-old Neolithic specimen from Germany, although this ancient DNA sample was not resolved further to additional sub-clade levels.39. In the Greek island of Crete, approximately 7%[18] to 11%[19] of males belong to haplogroup G. Semino O, Santachiara-Benerecetti AS, Falaschi F, Cavalli-Sforza LL, Underhill PA : Ethiopians and Khoisan share the deepest clades of the human Y-chromosome phylogeny. In addition, there are multiple other SNPs thought to have the same coverage as M201. A more compact cluster of Near/Middle Eastern samples is also resolved in the network. Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language. Y-chromosome lineages from Portugal, Madeira and Acores record elements of Sephardim and Berber ancestry. G1 is possibly believed to have originated in Iran. [25], In the Middle East, haplogroup G accounts for about 3% of the population in almost all areas. The emergence of Y-chromosome haplogroup J1e among Arabic-speaking populations. The British samples have inconsistent double values for STR marker DYS19 in many cases. Because SNPs provide the most reliable method of categorization, each is allowed to represent an official G category. [23] About 6% of the samples from Sri Lanka and Malaysia were reported as haplogroup G, but none were found in the other coastal lands of the Indian Ocean or Pacific Ocean in Asia. Herein . (Behar et al., 2012b) Origin Most researchers consider the birthplace of G to have been born in East Asia. It is a child of haplogroup M12'G. It was likely born in the East Asia around 32,000 years ago. Ancient DNA from European early neolithic farmers reveals their near eastern affinities. Am J Hum Genet 2000; 67: 15261543. Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau. Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ : Y-chromosome diversity characterizes the Gulf of Oman. To obtain Ashkenazi Jewish G2a1a men with northeastern European ancestry form a distinct cluster based on STR marker values. The effective mutation rate at Y chromosome short tandem repeats, with application to human population-divergence time. Google Scholar. This video explains the migration route of Y-chromosome haplogroup G and the countries where it can be found today. Although both broadly distributed, G2a-P15* and its downstream L91 sub-lineage have low frequencies, with the exception of Sardinia and Corsica. Elizabeth T Wood, Daryn A Stover, Christopher Ehret, L177, later discarded in favour of PF3359 and equivalent SNPs, was first identified at. First, we calculated haplogroup diversity using data in Supplementary Table S1 for the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. These patterns have been related to different migratory events and demographic processes.2, 10, 11, 14, 15, 16. But unusual values or unusual value combinations found at short tandem repeat markers (STRs) can also provide the basis of additional taxonomisation. (2000) suggested 17,000 years ago. (b) Principal component analysis by hg G sub-clades: (A) M285, P20, P287, P15, L92 P16, M286, M485, P303, U1, L497, M527, M406, Page19, M287 and M377 sub-haplogroups with respect to total M201. Then we applied a 10% overall hg G frequency threshold and the additional specification that both haplogroup G1 and G2 lineages also be present. Am J Hum Genet 2008; 82: 873882. The DYS391 marker has mostly a value of 10, but sometimes 11, in G2a2b1 persons, and DYS392 is almost always 11. The haplogroup G mutation developed about 21,000 to 14,000 years ago. It was then learned that several subclades belong under L223, including: G-L91 was identified in 2009. PLoS One 2011; 6: e17548. G-P16 has a high frequency in South and NW Caucasus, with the highest frequency among North Ossetians63.6%. Basically, haplogroups refer to organisms that have a common ancestor, identified by studying the nucleotide and mitochondrial mutations in cells. In the Russian North Caucasus the Kabardinian and Ossetian populations are also notable for high rates of G-M201. In the Americas, the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. ), Ancient G-M201s with sequencing[self-published source?] The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. volume20,pages 12751282 (2012)Cite this article. [39], Haplogroup G-M377 has been found at a frequency of 60% out of a sample of five Pashtuns in the Wardak region of Afghanistan. [44] The "U" SNPs were identified in 2006 but not published until 2009.[45]. suggested that: "We estimate that the geographic origin of haplogroup G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. All G-M377 men tested so far also have a rare null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic STR), the result of a RecLOH event, a finding not yet seen among most other G haplotypes. (Previously the name Haplogroup S was assigned to K2b1a4. Correspondence to These two reported Pakistani G-M377 haplotypes are quite divergent from the Ashkenazi Jewish clade, and therefore do not at all indicate a recent common origin. The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. Eur J Hum Genet 2004; 12: 855863. To accommodate for variability in sample sizes and hg G content, haplogroup diversity was calculated using the method of Nei37 only in the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. The Network 4.6.0.0 (Fluxus-Engineering) program was used (median-joining algorithm and the post-processing option). Although M527 frequency (Supplementary Table S1) is relatively low (16%), its phylogeographic distribution in regions such as southern Italy, Ukraine and the Levant (Druze and Palestinians) often coincides with areas associated with the Neolithic and post-Neolithic expansions into the Greek Aegean beginning approximately 7000 years ago.41 The expansion time (Td) of M527 is 71002300 years ago and is consistent with a Middle to Late Neolithic expansion of M527 in the Aegean. RV thanks the European Union Regional Development Fund for support through the Centre of Excellence in Genomics, the Estonian Ministry of Education and Research for the Basic Research grant SF 0270177As08. The North Ossetians in the mid northern Caucasus area of Russia belong overwhelmingly to the G2a1 subclade based on available samples. Notably no basal G-M201*, Page94*(xM285, P287) chromosomes were detected in our data set. Eur J Hum Genet 2009; 17: 820830. G-P303*, also known as G2a2b2a* (previously G2a3b1*), and its subclades are now concentrated in southern Russia and the Caucasus, as well as, at lower levels, other parts of Europe and South West Asia, especially an area including Turkey, Iran and the Middle East where G2a2b2a may have originated. The complexity is apparent in both the phylogenetic resolution and geographic patterning within hgs G and J2a.